4.7.2 Sequences for TEM gene> TEM SAMPLE-1                    403GGGTAAATAAAGATTGCTGAAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGAAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACAATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGT> TEM SAMPLE-2                757CGCGAACCCACTGAAGCTAGGATATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAACATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGGATGAACGAAATAGACAGATCGCTGAAGATAGGAT> TEM SAMPLE-3             603  GTTGAAGTAAAGGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGCATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTATCAGTGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTAT> TEM SAMPLE-4                        761 CGAAGAAAGCACTGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGGATGAACGAAATAGACAGATCGCTGAGATAGGTGGGGAGGGGA>TEM SAMPLE-5                       757       CGATTAGTAAGGATGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTTGGAGATAGGACGGG 4.7.3 Sequences for CTX-M gene> CTX-M  SAMPLE-1                 752      TGTCATCACTCTTTTTTGTGCTGAGTGTTGTCCGAGCATGTCTGTTAATCAGCAAGTTGACATCCATCATCTGACCTTGTTAACTATAATCCGATTGCGGAAATGCTGAACAATGGGACGATGTCAGTGGCTGAGCTTAGCGCGGCCGCGCTTTATTTTGAGATAACGTGTGCATGAATAAGCTGATTGCTCACGTTGGTTGCCCGGCTAAAGTCACCTTATTCTCCCGACCTCTGTTACACCAAGTTTTCCATCTCGACCGTACCGACTGGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCTCCTCGGGTTTCGTGTCACACTCGGCCTAATCTGACTTTGGGGAAAGCATTGGGTGATGCCAACGGGCGCAGCTGGTGACATGAATGATTGGCGATAGCACCGGTGCATGTTTGATTCGGGCGGGACTGCCTGCTTCCTGGGTTGCGTTGGATAAAACCGGCATCTGATGAAAAGAAAAAATTGATGTCAAAATGTGATGGTTGCTATGAGCGTGTCGCCCAAGGTATGAAACCGGTCTGTGTTGAATCTTGTCCACAACGTGCACTGGATTTTGATGATATTGAAGTGATCAGAGCGAAACATGGTACAGAGTGTGGTATCGCACCAATGCCAGATCCGGCTTAACTGACCCAAATATCGTGATAAAGCACATAAGGATGCAATACCTTCCGGTGATAAACCGGCACCACGTTTTGATGTCTAGTGATTTCGAAT> CTX-M  SAMPLE-2                 679                    GTAGAGAGCAGGATGCTGAGAAGTGAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGACCTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCACTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATAAGCTGATTGCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCTGGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCACCTCGGGCAATGGCGCAAACTCTGCGGAATCTGACGCTGGGTAAAGCATTGGGCGACAGCCAACGGGCGCAGCTGGTGACATGGATGAAAGGCAATACCACCGGTGCAGCGAGCATTCAGGCTGGACTGCCTGCTTCCTGGGTTGTGGGGGATAAAACCGGCAGCAGATAATAAAACTGATTGATGTCAAAATGGGATGTTTGCTATTAACTTGTTGCCCAAGGTATGGCACGTGTCTGTGTTGAATCTTGTCCACAACGTGCACTGTATTTTGGATGATATTGAAGTGATCAGAGCGAACAGGGTACAGAAGTGTGGGATCGCCCCGGGCCAGATCCAAGCTTAAGTAACCCAAATAGCCGG> CTX-M  SAMPLE-3                        235GATAAAGAAAAGGTCTGAGAAGTGAAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGATTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGATGATGTCGCTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGGTAAATAAGCTGATTGCTCCTCCCGGGGGAGGGGCAAACGACAATAGTTAGAAGAGAGAGGGGA4.7.4 Sequences for qnrS gene> qnrS  SAMPLE-1                                           452GGTTCGGTTTACCGAGGACGGGTGATATCGAAGGCTGCCACTTTGATGTCGCAGATCTTCGTGATGCAAGTTTCCAACAATGCCAACTTGCGATGGCAAACTTCAGTAATGCCAATTGCTACGGTATAGAGTTCCGTGCGTGTGATTTAAAAGGTGCCAACTTTTCCCGAACAAACTTTGCCCATCAAGTGAGTAATCGTATGTACTTTTGCTCAGCATTTATTTCTGGATGTAATCTTTCCTATGCCAATATGGAGAGGGTTTGTTTAGAAAAATGTGAGTTGTTTGAAAATCGCTGGATAGGAACGAACCTAGCGGGTGCATCACTGAAAGAGTCAGACTTAAGTCGAGGTGTTTTTTCCGAAGATGTCTGGGGGCAATTTAGCCTACAGGGTGCCAATTTATGCCACGCCGAACTCGACGGTTTAGATCACGCAAGTTAGCACGTCACA> qnrS  SAMPLE-2                                        457GTTTGGGTACGATCACATCGACAGGGTGATATCGAGGCTGCCACTTTGATGTCGCAGATCTTCGTGATGCAAGTTTCCAACAATGCCAACTTGCGATGGCAAACTTCAGTAATGCCAATTGCTACGGTATAGAGTTCCGTGCGTGTGATTTAAAAGGTGCCAACTTTTCCCGAACAAACTTTGCCCATCAAGTGAGTAATCGTATGTACTTTTGCTCAGCATTTATTTCTGGATGTAATCTTTCCTATGCCAATATGGAGAGGGTTTGTTTAGAAAAATGTGAGTTGTTTGAAAATCGCTGGATAGGAACGAACCTAGCGGGTGCATCACTGAAAGAGTCAGACTTAAGTCGAGGTGTTTTTTCCGAAGATGTCTGGGGGCAATTTAGCCTACAGGGTGCCAATTTATGCCACGCCGAACTCGACGGTTTAGATCACGCAAGTTAGCACGTCACAGG4.8 Multiple Sequence Alignment4.8.1 CLUSTAL 2.1 multiple sequencealignment for 16Sr RNA gene2     –GGGGGGGCTTTGGCACGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  584     AGCCTTGTCATCATATCGTACTATTCTACTTATCTCTACGCATTTCACCGCTACACCTGG  601     —AGACATCCCATCGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  573     —-AGGGGGCCTTGGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  56                              * ** *  *****************************        2     AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA 1184      AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  1201     AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  1173     AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  116      ************************************************************ 2     GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  1784     GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  1801     GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  1773     GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  176      ************************************************************ 2     CCAATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  2384     CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  2401     CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  2373     CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  236       *********************************************************** 2     TCTTCTGCGGGTAACGTCT-TGACCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  2974     TCTTCTGCGGGTAACGTCAATGAGTAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  3001     TCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  2973     TCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  296      ******************  ***  *********************************** 2     AAGTACTTTACAACCAGAAGGCCTTCTTCATACACACGACATGGATGCATCAAGCTTGCG  3574     AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  3601     AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  3573     AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  356      *************** ******************* ** ***** ******* ******* 2     GCCCATTG—————————————————-  3654      CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  4201     CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  4173     CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  416       **  *                                                       2     ————————————————————  3654     CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  4801     CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  4773     CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  476                                                                   2     ————————————————————  3654     CCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT  5401     CCACCTACGAGCTAAACCCATCTGGGCACATCCGATGGCAAGAA—————-  5213     CCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT  536                                                                   2      ————————————————————  3654     CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCAT  6001     ————————————————————  5213     CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCAT  596                                                                   2     ————————————————————  3654     CAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCGAAACAGCAAGCTGC  6601     ————————————————————  5213     CAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCAAAGAAGCAAGCTTC  656                                                                   2     —————————–     3654     TTCCTGTTACCGTTCGCTTTTGGCATGTA     6891     —————————–     5213     TTCCTGTTACCGTTCGACTTGCATGTAAA     685                                    4.8.2 CLUSTAL2.1 multiple sequence alignment for TEM gene      1      GGGTAAATAAAGATTGCTGAAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     602      CGCGAACCCACTGAAGCTAGGATATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     603      -GTTGAAGTAAAGGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     594      —-CGAAGAAAGCACTGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     565      —CGATTAGTAAGGATGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     57                            * ************************************* 1      TCTCAACAGCGGTAAG-ATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGA     1192      TCTCAACAGCGGTAAC-ATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGA     119