Abstract pneumonia, septicemia, and endocarditis, toxic shock syndrom,

Abstract

Background: Staphylococcus aureus is a serious a public health and current health care concern. The ability of S.aureus to form biofilm is considered to be a major virulence factor influencing its pathogenesis in burn patients.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Materials and Methods: Totally, 96 pus/wound swab samples were obtained from burn patients. Fifty bacteria isolate phenotypically and genotypically distinguished as Staphylococcus aureus. Antibiotic resistance pattern and minimum inhibitory concentration were determined. The capability of biofilm formation was investigated by modifying Tissue Culture Plate method. icaADBC operon-encoded polysaccharide intercellular adhesion and exfoliative toxin gene were detected by polymeras chain reaction method.

Results:A total of 50 strains isolated 47(94%) strains were capable to produce a biofilms. Based on the biofilm production level, 25(50%),12(24%),10(20%) isolates reaction were strong, moderate and weak positive, respectively. Between the isolates, 15(30%), 22(44%) and 13(26%) strains were methicillin-resistant and sensitive S. aureus (MRSA-MSSA), and multidrug resistance (MDR), respectively. The presence of biofilm formation genes was directly associated with biofilm formation. So that, the prevalence of the icaA, icaB, icaC, icaD and ica R genes among the studied isolates were 23(92%),20(80%),20(80%),24(96%),and 21(84%), respectively. The Outbreak of exfoliative toxin A and B in Staphylococcus aureus were 84%-92%, respectively.

Conclusion: Our findings showed that biofilm formation ability and antibiotic resistance patterns in different clinical isolates of S. aureus in burn patients. Moreover, the bacterial biofilms showed enhanced tolerance to antibiotics and this is a serious problem in the burn intensive care unit. Linezolid, vancomycin and quinoprestin/dalfoprestin can be used for the preliminary treatment of the serious infections caused by S. aureus.

Keywords: S. aureus, Biofilm, MRSA, Linezolid, Burn patients

 

 

Introduction

Staphylococcus aureus is a serious a public health and modern healthcare concern. S. aureus has remained an important human pathogen causing a wound, respiratory tract, skin and tissue infections, pneumonia, septicemia, and endocarditis, toxic shock syndrom, a device related infections as sporadic and epidemical (1-3). Burn injury is one of the most common types of harmful forms of trauma that require crucial care medicine (4, 5). Burn injury patients are at high risk of infections (6). The incidence of bacterial wound contamination has a direct relationship with the risk of sepsis (6, 7). Staphylococcus species and Pseudomonas aeruginosa are two of the most commonly isolated microorganisms from burn wounds around the world (4, 8).The deployment of multidrug resistance by S.aureus particularly Methicillin-resistant Staphylococcus aureus challenging clinicians and infection control organization through the worldwide (9, 10). The development of strains resistant to methicillin and other antibacterial agent has become an important problem in the hospitals and community, because of the higher mortality (11). The capability of  S.aureus to colonization on epithelial surfaces has been found to be associated with the production of biofilm (12, 13). Biofilm is structure community of bacteria, which formed of multiple layers, the cluster enclosed in an exopolysaccharide glycocalyx and able of adhering to an insert or living surface (14, 15). The result of studies showed that the initial step of Staphylococcal infection is the attachment to the surface of various materials, including medical devices and host tissue (16). Biofilm is the basis for persistent or chronic bacterial infections and is considered to be a two-step manner, the bacteria in primary step adhere to any other and then develop a biofilm (14, 17). This step is mediated by a polysaccharide intercellular adhesion (PIA( and the intercellular adhesion (ica) locus consisting of the genes (ica A, ica B, ica C , ica D) encodes the proteins required for the synthesis of a polysaccharide intercellular adhesion (PIA(  and capsular polysaccharide adhesin (PSA) which are the important biofilm components in staphylococcal species (12, 14, 17, 18). S. aureus generates a variety of extracellular protein toxins, Consist of enterotoxins, exfoliative toxin A-B, hemolysins and Panton-Valentine leukocidin. Some strains of S. aureus producing one or both of two ETA or ETB, have been associated with a group of impetiginous staphylococcal diseases correlated to as staphylococcal scalded-skin syndrome (19).The current study was carried out to determine the antibiotic resistance and biofilm production among the strains of S. aureus isolated from burn patients.

 

Material and Methods

Specimen collection and S. aureus isolation

In a cross-sectional study, microbiological wound swabs were obtained from 95 patients with clinical signs and symptoms of burn wound infection in Burn Intensive care Unit (BICU), Besat Hospital of Hamadan, west of, Iran, between March to August 2017. A sterile swab was used for sampling of all burn patients. The swabs were obtained by the attending physicians and collected from deep regions of the burns before any washing. Identification of S. aureus was performed by standard microbiological methods included Gram staining, growth on Mannitol salt agar (MSA)(Merck, Germany), Catalase, DNase and coagulase test (20). The S.aureus isolates were confirmed by PCR for the presence of the nuc gene (3).

Antimicrobial susceptibility Testing

The antimicrobial susceptibility using the following disc (Mast Co, England):  Cefoxitin (FOX 30µg), Gentamicin (GM 10 µg), Vancomycin (VA 30ug), Trimethoprim/Sulfamethoxazole (TS 25 µg), Clindamycin ( CD 2 µg) , quinoprestin/dalfoprestin (SYN  15 µg) , linezolid (LZD,  30 µg) , Ciprofloxacin (CF 5 µg),  and Imipenem (IMI 10 µg), was performed by the modified Kirby Bauer Disc diffusion method and interpreted according to Clinical Laboratory Standards (CLSI) guidelines (21). The S. aureus ATCC 25923 was included as control strain.

Identification of methicillin resistant staphylococcus aureus

Minimum inhibitory concentration (MIC) assays were performed by the micro broth dilution method in 96-well plates (Costar®, Corning, NY, USA), in accordance with recommendations from the CLSI (36). All S. aureus isolates for which the MIC of Cefoxitin was ?8 ?g/ml were classified as MRSA. Methicillin resistance was identified by the presence of the mecA gene by PCR as explained previously (3). In briefly, DNA was prepared using a genomic DNA purification kit (Gene Mark, Taiwan) according to the manufacturer’s recommendations.  S.aureus  isolated  was  tested  for  the  presence of the 310 base pair  PCR  product  of  mecA  gene,  using  the  following primers:  forward (5?- GTAGAAATGACTGAACGTCCGATAA-3?) and reverse (5?- CCAATTCCACATTGTTTCGGTCTAA -3?). S. aureus ATCC 25923 was included as a positive control.

Biofilm production assay

S. aureus biofilm formation was determined using the microtiter plate assay flat-bottom 96-well microtiter plates, as described previously (22). Briefly, S. aureus strains were individually grown overnight in Trypticase Soy Broth (TSB) media at 37 °C and diluted 1:10 in TSB (Merck, Germany) containing 1% glucose. 200 µL of the cell suspension per well added in 96-well microtiter plates and incubated for 24 h at 37 °C. The wells were washed three times with 200 ml of sterile phosphate buffered saline (PBS, pH 7.4), dried at room temperature and finally stained with 1% crystal violet for 15 min. S. aureus ATCC 25923 and S. epidermidis ATCC 12228 were used as positive and negative controls, respectively. The absorbance of the adherent biofilm was measured at 570 nm in a microplate reader. The results were divided into the four following categories according to their optical densities as (1) strong biofilm producer (0.825