Abstract pneumonia, septicemia, and endocarditis, toxic shock syndrom,

Abstract

Background: Staphylococcus aureus is a serious a public health and current health care concern. The ability of S.aureus to form biofilm is considered to be a major virulence factor influencing its pathogenesis in burn patients.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Materials and Methods: Totally, 96 pus/wound swab samples were obtained from burn patients. Fifty bacteria isolate phenotypically and genotypically distinguished as Staphylococcus aureus. Antibiotic resistance pattern and minimum inhibitory concentration were determined. The capability of biofilm formation was investigated by modifying Tissue Culture Plate method. icaADBC operon-encoded polysaccharide intercellular adhesion and exfoliative toxin gene were detected by polymeras chain reaction method.

Results:A total of 50 strains isolated 47(94%) strains were capable to produce a biofilms. Based on the biofilm production level, 25(50%),12(24%),10(20%) isolates reaction were strong, moderate and weak positive, respectively. Between the isolates, 15(30%), 22(44%) and 13(26%) strains were methicillin-resistant and sensitive S. aureus (MRSA-MSSA), and multidrug resistance (MDR), respectively. The presence of biofilm formation genes was directly associated with biofilm formation. So that, the prevalence of the icaA, icaB, icaC, icaD and ica R genes among the studied isolates were 23(92%),20(80%),20(80%),24(96%),and 21(84%), respectively. The Outbreak of exfoliative toxin A and B in Staphylococcus aureus were 84%-92%, respectively.

Conclusion: Our findings showed that biofilm formation ability and antibiotic resistance patterns in different clinical isolates of S. aureus in burn patients. Moreover, the bacterial biofilms showed enhanced tolerance to antibiotics and this is a serious problem in the burn intensive care unit. Linezolid, vancomycin and quinoprestin/dalfoprestin can be used for the preliminary treatment of the serious infections caused by S. aureus.

Keywords: S. aureus, Biofilm, MRSA, Linezolid, Burn patients

 

 

Introduction

Staphylococcus aureus is a serious a public health and modern healthcare concern. S. aureus has remained an important human pathogen causing a wound, respiratory tract, skin and tissue infections, pneumonia, septicemia, and endocarditis, toxic shock syndrom, a device related infections as sporadic and epidemical (1-3). Burn injury is one of the most common types of harmful forms of trauma that require crucial care medicine (4, 5). Burn injury patients are at high risk of infections (6). The incidence of bacterial wound contamination has a direct relationship with the risk of sepsis (6, 7). Staphylococcus species and Pseudomonas aeruginosa are two of the most commonly isolated microorganisms from burn wounds around the world (4, 8).The deployment of multidrug resistance by S.aureus particularly Methicillin-resistant Staphylococcus aureus challenging clinicians and infection control organization through the worldwide (9, 10). The development of strains resistant to methicillin and other antibacterial agent has become an important problem in the hospitals and community, because of the higher mortality (11). The capability of  S.aureus to colonization on epithelial surfaces has been found to be associated with the production of biofilm (12, 13). Biofilm is structure community of bacteria, which formed of multiple layers, the cluster enclosed in an exopolysaccharide glycocalyx and able of adhering to an insert or living surface (14, 15). The result of studies showed that the initial step of Staphylococcal infection is the attachment to the surface of various materials, including medical devices and host tissue (16). Biofilm is the basis for persistent or chronic bacterial infections and is considered to be a two-step manner, the bacteria in primary step adhere to any other and then develop a biofilm (14, 17). This step is mediated by a polysaccharide intercellular adhesion (PIA( and the intercellular adhesion (ica) locus consisting of the genes (ica A, ica B, ica C , ica D) encodes the proteins required for the synthesis of a polysaccharide intercellular adhesion (PIA(  and capsular polysaccharide adhesin (PSA) which are the important biofilm components in staphylococcal species (12, 14, 17, 18). S. aureus generates a variety of extracellular protein toxins, Consist of enterotoxins, exfoliative toxin A-B, hemolysins and Panton-Valentine leukocidin. Some strains of S. aureus producing one or both of two ETA or ETB, have been associated with a group of impetiginous staphylococcal diseases correlated to as staphylococcal scalded-skin syndrome (19).The current study was carried out to determine the antibiotic resistance and biofilm production among the strains of S. aureus isolated from burn patients.

 

Material and Methods

Specimen collection and S. aureus isolation

In a cross-sectional study, microbiological wound swabs were obtained from 95 patients with clinical signs and symptoms of burn wound infection in Burn Intensive care Unit (BICU), Besat Hospital of Hamadan, west of, Iran, between March to August 2017. A sterile swab was used for sampling of all burn patients. The swabs were obtained by the attending physicians and collected from deep regions of the burns before any washing. Identification of S. aureus was performed by standard microbiological methods included Gram staining, growth on Mannitol salt agar (MSA)(Merck, Germany), Catalase, DNase and coagulase test (20). The S.aureus isolates were confirmed by PCR for the presence of the nuc gene (3).

Antimicrobial susceptibility Testing

The antimicrobial susceptibility using the following disc (Mast Co, England):  Cefoxitin (FOX 30µg), Gentamicin (GM 10 µg), Vancomycin (VA 30ug), Trimethoprim/Sulfamethoxazole (TS 25 µg), Clindamycin ( CD 2 µg) , quinoprestin/dalfoprestin (SYN  15 µg) , linezolid (LZD,  30 µg) , Ciprofloxacin (CF 5 µg),  and Imipenem (IMI 10 µg), was performed by the modified Kirby Bauer Disc diffusion method and interpreted according to Clinical Laboratory Standards (CLSI) guidelines (21). The S. aureus ATCC 25923 was included as control strain.

Identification of methicillin resistant staphylococcus aureus

Minimum inhibitory concentration (MIC) assays were performed by the micro broth dilution method in 96-well plates (Costar®, Corning, NY, USA), in accordance with recommendations from the CLSI (36). All S. aureus isolates for which the MIC of Cefoxitin was ?8 ?g/ml were classified as MRSA. Methicillin resistance was identified by the presence of the mecA gene by PCR as explained previously (3). In briefly, DNA was prepared using a genomic DNA purification kit (Gene Mark, Taiwan) according to the manufacturer’s recommendations.  S.aureus  isolated  was  tested  for  the  presence of the 310 base pair  PCR  product  of  mecA  gene,  using  the  following primers:  forward (5?- GTAGAAATGACTGAACGTCCGATAA-3?) and reverse (5?- CCAATTCCACATTGTTTCGGTCTAA -3?). S. aureus ATCC 25923 was included as a positive control.

Biofilm production assay

S. aureus biofilm formation was determined using the microtiter plate assay flat-bottom 96-well microtiter plates, as described previously (22). Briefly, S. aureus strains were individually grown overnight in Trypticase Soy Broth (TSB) media at 37 °C and diluted 1:10 in TSB (Merck, Germany) containing 1% glucose. 200 µL of the cell suspension per well added in 96-well microtiter plates and incubated for 24 h at 37 °C. The wells were washed three times with 200 ml of sterile phosphate buffered saline (PBS, pH 7.4), dried at room temperature and finally stained with 1% crystal violet for 15 min. S. aureus ATCC 25923 and S. epidermidis ATCC 12228 were used as positive and negative controls, respectively. The absorbance of the adherent biofilm was measured at 570 nm in a microplate reader. The results were divided into the four following categories according to their optical densities as (1) strong biofilm producer (0.825 < OD620); (2) medium biofilm producer (0.55 ? OD620 ? 0.825); (3) weak biofilm producer (0.275?  OD620 < 0.55); and (4) non-biofilm (OD620 ? 0.275) (22). Detection of biofilm formation related genes intercellular adhesion gene cluster (ica) (ica A, ica B, ica C, ica D, ica R) The simplex and multiplex PCR was conducted to determine the frequency of biofilm encoding genes in 25 S. aureus isolates. The primer sets for detection of biofilm genes were previously described by Sahab Atshan et al., as shown in Table 1 (24). The reaction mixture of PCR was 25 ?L in total volume containing 12.5 ?L of master mix, 0.5 ?L of each forward and reverse primers, 2 ?L of genomic DNA, and 9.5?L of distilled water. The PCR performed with an initial denaturation at 95°C for 5 min and followed for 40 cycles of denaturation at 95°C for 2 min, annealing at 60°C for 20 second and elongation at 72°C for 20 second. The final elongation was at 72°C for 5 min. The PCR performed for detection ica R according to study by Dan Yu et al. (25). The amplified products were subjected to 2% agarose gel electrophoresis. The standard strain S. aureus ATCC 25923 was included as a positive control for the PCR assays. For the negative control, sterile water was added rather of DNA. Detection of exfoliative toxin A-B genes (eta, etb) PCR was performed with a final volume of 20 ml according to the Master Mixes of components.  Each reaction contained 12  ml of Master Mix, 1 ml of each primer (Table 1), 2 ml of DNA as template, 4 ml of RNase-free water. The amplification conditions were 94 °c for 5 min followed by 35 cycles of amplification (denaturation at 94 °C for 1 min, annealing at 55°C for 1 min, and an extension at 72 °C for 1 min), and a final extension at 72 °C for 6 min. Statistical Analysis The frequencies of  the biofilm and exfoliative toxin A-B genes and antibiotic sensitivity and resistance patterns among the MRSA (mecA+) and MSSA (mecA?) S. aureus strains were analyzed using Chi-squared tests. P values of ?0.05 indicated statistical significance.     Result Bacterial isolates From 96 pus/wound swab samples processed, 80 (84.21%) were bacterial culture positive. Out of which, S. aureus was isolated from 50 (62.5%) samples. The most frequent bacteria isolated from cultured positive were Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii and Staphylococcus epidermidis, respectively. Among the 50 S. aureus isolated, 13(26%), 15(30%), 22(44%) isolates were MDR, MRSA and MSSA, respectively Table 2. These isolates were collected from the Burn Intensive care Unit (BICU). Antimicrobial susceptibility testing The antibiogram results of the S.aureus isolates shown in Table 3. All clinical isolates of S.aureus were susceptible to linezolid, vancomycin, and quinoprestin/dalfoprestin. Nevertheless, they showed various levels of resistance and susceptibility to other antibiotics, with the highest resistance shown to cefoxitin, ciprofloxacin, and gentamicin and the greatest susceptibility exhibited to trimethoprim/sulfamethoxazole and imipenem. The patterns of antibiotic resistance among the MRSA isolates showed the highest resistance to ciprofloxacin Table 3. Out of 50 S. aureus isolates, 15(30%) were methicillin-resistant with cefoxitin disk diffusion method and in addition by detection of mecA gene, of which, 13(26%) isolates were resistant to all the used an­tibiotics (MDR-MRSA) including ciprofloxa­cin, gentamicin, clindamycin, and trimethoprim-sulfamethoxazole. Determination of the minimum inhibitory concentration    Minimum inhibitory concentration of clindamycin, trimethoprim/sulfamethoxazole, gentamicin and cefoxitin were determine according to CLSI recommendations. The results were summarized in Table 4. The minimum inhibitory concentration (MIC) test showed that the resistance to antibiotics in Staphylococcus aureus strains have the different MIC.   The result of identification of biofilm formation by phenotypically method The frequency distribution of biofilm formation among the 50 clinical isolates of S. aureus, 94% (n = 47) were able to form a biofilm and 6% (n = 3) were non biofilm formers on microtiter plate Table 5. The frequency of biofilm formation and exfoliative toxin genes in MRSA and MSSA and MDR strains Genes encoding intercellular adhesion proteins (ica A, ica D.ica C,ica B,ica R) were detected in  25 S. aureus isolates. Between  25 S. aureus isolates 96% (n =24) of the strains were positive for ica A and ica D genes. There were ica C and ica B in 80%, and ica R was found in 84% of isolates. Among  25 S. aureus isolates 84% (n =21) and  92% (n =23) of the strains were positive for eta and etb genes, respectively (Figure 1-2-3-4).   Association of antibiotic resistance in MRSA and MSSA and MDR strains   The highest antibiotic resistance to antibiotics clindamycin and imipenem was observed among MDR strains. The results of this study showed the highest resistance to antibiotics Trimethoprim/Sulfamethoxazole and Ciprofloxacin among MRSA and MSSA strains (Fig 5). Association of biofilm formation and antibiotic resistance in MSSA and MRSA, MDR isolates   Statistical analysis showed that MRSA strains were strong biofilm producers. MRSA strains exhibited more resistance to antibiotics due to biofilm production (Fig  6).  The mean for biofilm biomass in S.aureus MSSA and MRSA isolates were 0.907±0.260 and 1.20 ± 0.315, respectively. The mean for biofilm biomass in total MDR and non-MDR isolates were 0.949 ± 0.289 and 0.656±0.326 respectively. Statistical analysis revealed a significant correlation between MRSA multidrug resistant phenotypes and biofilm formation ability (p=0.007). Discussion The virulence of  S. aureus is associated with its capacity with the ability to adhere and form the biofilm on host surfaces and extracellular protein toxins production and resistance to antibiotics (18, 26). The ability of S. aureus to produce biofilms helps the bacterium to remain within the host and is considered to be responsible for chronic or persistent infections (14, 27). Consequently, biofilm formation is an essential virulence factor of S. aureus and several mechanisms are used by MSSA and MRSA for biofilm formation. Clinical MSSA and MRSA strains mainly form biofilm dependent on the icaADBC operon (18, 26). Infection in burn wound is one of the most common types of trauma that requires necessary medical care and cause of morbidity and mortality in both developed and developing countries (5, 28). Between 96 positive cultures obtained from burn patients  swab samples, 50 (62.5%) S.aureus were isolated. The most frequent bacteria isolated from cultured positive were Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii and Staphylococcus epidermidis, respectively. S.aureus was the most commonly isolated bacteria amongst burn patients with burn wound infection in Hamadan city. This finding is similar to the results study performed by Aynalem Mohammed et al.(29), Tigist Alebachew et al.(30), Neelam Taneja et al.(31). According to the results of this study, high antibiotic resistance was observed in s. aureus strains. In addition, the high prevalence of s. aureus in burn patients with burn wound infection can a serious risk. Among the isolated S. aureus, 15 (30%) were MRSA and 35 (70%) were MSSA which was more or less similar to the other studies (32-34). This rate of MRSA in this study was less than another study, which on burn wound infection in Iran, where it was shown that (61.53%) isolates were MRSA (15). The outbreak of MRSA varies in different burn units, which may be due to the performance of various infection control procedures. The spread of methicillin resistance amongst S.aureus strains led to problems in the treatment of infections caused by this MRSA (35). The S. aureus isolates described in this study were quite susceptible to Vancomycin and Linezolid and quinoprestin/dalfoprestin and these results are similar to the previous study (36). The present study suggested differential resistance rates against Ciprofloxacin, Gentamicin, and Clindamycin at rates of 30%, 28%, and 30%, respectively. These rates are lower than that of other studies, that showed resistance rates against Ciprofloxacin, Gentamicin, of 52% and 70%, respectively (15). This study confirmed that overall rates of susceptibility to generally prescribed antibiotics in S.aureus isolates were above 75%, with the exception of Vancomycin and Linezolid and Quinupristin/dalfopristin. Amongst the 13 isolates of Methicillin-resistant Staphylococcus aureus showed MDR and this alarms that multiple drug-resistant strains of S.aureus. The pattern of bacterial resistance is important for epidemiological and clinical purposes. The results of the antimicrobial resistance pattern to give serious cause for concern because the predominant bacterial isolates were highly resistant to the commonly available antimicrobial agents. A related observation of high antimicrobial resistance by biofilm producing bacterial isolates has been performed in other studies (36). In the current study, biofilm formation was seen in 94% isolates, while 6% bacterial isolates showed no biofilm production.  In our study, the majority (94%) of S.aureus produced biofilm, and most (100%) of the biofilm-producing S.aureus isolates were Methicillin resistant (MRSA) (p<0.05). Among MRSA strains strong biofilm producer, the high antibiotic resistance was observed. While in strains that did not produce biofilm less resistance was observed. This confirms the importance of biofilm in increasing the duration of treatment in patients with burn wound infection. Similar results were shown by Ohadian Moghadam et al. (15). Burn wound infection isolates that were resistant to multiple antibiotics were mostly biofilm producers, indicating that the majority of MDR pathogens are biofilm producers. A relationship was observed with other studies (4). In the present study, biofilm producing bacterial isolates displayed a high level of resistance to all drugs that are commonly prescribed, like Ciprofloxacin, Gentamicin, and Clindamycin. The categories of biofilm among all of the S. aureus isolates were weak (20 %%), Moderate (24%) and strong (50%) and 6% isolates were non biofilm formers. Our study indicated that ica A, ica D (96%) was the most frequent gene in the S.aureus isolates from burn patients. Our analysis also showed that the frequency of ica A, ica D had the significant difference between biofilm production and resistance antibiotic (p< 0.05). Similar to our findings, many recent studies reported the similar prevalence of the ica A and ica D biofilm genes in S.aureus can produce a multilayered biofilm (29). The frequency of biofilm genes (ica B and ica C, ica R) in the S.aureus isolates was similar to past studies (38). Another virulence factor studied in these strains was exfoliative toxin A and B genes. The exfoliative toxin is of predominant importance in Staphylococcus aureus. The prevalence of exfoliative toxin A and B genes in the study were very high. Zarei Koosha  et al.  studied the prevalence of exfoliative toxin A and B genes in Staphylococcus aureus isolated from clinical specimens. They reported  186 (94.4%), 15 (7.6%) of the 197 isolates expressed  the  eta, etb,  respectively. That the high prevalence of eta genes was the same with the current study (39). Regarding to the frequency of biofilm genes and the ability of biofilm formation, the significant statistical difference was observed between MRSA and MSSA S. aureus strains. In the current study, some significant points concerning the parameters (pattern antibiogram, biofilm production, prevalence biofilm and exfoliative toxin A and B  gene, determine the minimal inhibitory concentration antibiotics and identification MRSA) needed on the risk of S.aureus in burn wound infections were determined. Our finding would be applied in the improvement of treatment plans to control burn wound infections. Consequently, increase awareness of the mechanisms underlying biofilm formation and development of drug resistance will allow us to more efficiently control and treat biofilm infections. Conclusion Wound infection by pathogenic bacteria and developing antibiotics resistance are of the most serious health threats facing the burn patients.We observed a high rate of antimicrobial resistance and biofilm production in s.aureus isolates collected from burn patients. Furthermore, keeping in mind the high rate of biofilm production amongst the strains of S. aureus and high rate of drug resistance amongst the biofilm producing strains, detection of biofilm formation should also be included in the conventional tests and molecular test. Nevertheless, we suggest using linezolid and vancomycin and quinoprestin/dalfoprestin for the preliminary treatment of the serious infections caused by S. aureus. This report confirms high rates of MRSA and resistance to other drugs in S.aureus isolated in wound infection the burn patient. There is a requirement for longitudinal surveillance of MRSA and its antimicrobial susceptibility profile in the burn patient. Acknowledgments This investigation is a part of Ph.D. thesis, approved and financially supported by the vice chancler of research and technology of Hamedan university of Medical Sciensec, Hamedan, Iran. Conflict of interest None of the authors have any conflicts of interest to this article.